Browse wiki

Jump to: navigation, search
Sequence 1095(rif 3 , rif3)
Application Gene silencing +
Chemistry RNA +
Description RAP1 interacting factor homolog ( yeast ) Ensembl: ENSG00000080345 UniGene: Hs.655671 EntrezGene: 55183 Ensembl Chr2: 151974674 - 152042109 Strand: 1 GO terms: 0000781 0001939 0001940 0005524 0005634 0005694 0006974 0007049 0016887
Design SiRNA +
Name rif_3 , rif3  +
Sequence siRNA sense (21b) GAGAAACCAGGTTCTGAAGTT / siRNA antisense (21b) CTTCAGAACCTGGTTTCTCTT
Target RIF1 ( Homo sapiens ) +
Categories Sequence  +
Modification┬ádateThis property is a special property in this wiki. 2 March 2015 02:21:22  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders