Browse wiki
Sequence 1100(M 28S) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Description | Ensembl: ENSMUSG00000089855 |
Design | Primer set + |
Name | M 28S + |
Sequence | Forward PCR primer (24b) ATACCGGCACGAGACCGATAGTCA / Reverse PCR primer (22b) GCGGACCCCACCCGTTTACCTC |
Target | Rn28s1 ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:53 + |
hide properties that link here |
No properties link to this page. |