Browse wiki
| Sequence 1107(S6K2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Ribosomal protein S6 kinase, 70kDa, polype … Ribosomal protein S6 kinase, 70kDa, polypeptide 2 Ensembl: ENSG00000175634 UniGene: Hs.534345 EntrezGene: 6199 Ensembl Chr11: 66952511 - 66959454 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004713 0005524 0006412 0006468 0007165 0016740 004349124 0006412 0006468 0007165 0016740 0043491 |
| Design | ShRNA + |
| Name | S6K2 + |
| Sequence | (56b) GGCTGAGCGGAACATTCTAGTTCAAGCTTCTAGAATGTTCCGCTCAGCCCTTTTTG |
| Target | RPS6KB2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:24 + |
| hide properties that link here |
| No properties link to this page. |
