Browse wiki

Jump to: navigation, search
Sequence 1109(NgR-2 , NgR2)
Application Gene silencing +
Chemistry RNA +
Description Reticulon 4 receptor Ensembl: ENSRNOG00000030920 UniGene: Rn.45686 EntrezGene: 113912 Ensembl Chr11: 84839082 - 84840482 Strand: -1 GO terms: 0004872 0005515 0005783 0005886 0007409 0048503
Design SiRNA +
Name NgR-2 , NgR2  +
Sequence siRNA sense (21b) CCTCACGCATCTCTTTCTGTT / siRNA antisense (21b) CAGAAAGAGATGCGTGAGGTT
Target Rtn4r ( Rattus norvegicus ) +
Categories Sequence  +
Modification┬ádateThis property is a special property in this wiki. 2 March 2015 02:21:05  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders