Browse wiki
| Sequence 1109(NgR-2 , NgR2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Reticulon 4 receptor Ensembl: ENSRNOG00000030920 UniGene: Rn.45686 EntrezGene: 113912 Ensembl Chr11: 84839082 - 84840482 Strand: -1 GO terms: 0004872 0005515 0005783 0005886 0007409 0048503 |
| Design | SiRNA + |
| Name | NgR-2 , NgR2 + |
| Sequence | siRNA sense (21b) CCTCACGCATCTCTTTCTGTT / siRNA antisense (21b) CAGAAAGAGATGCGTGAGGTT |
| Target | Rtn4r ( Rattus norvegicus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:05 + |
| hide properties that link here |
| No properties link to this page. |
