Browse wiki
Sequence 1110(NgR-3 , NgR3) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Reticulon 4 receptor Ensembl: ENSRNOG00000030920 UniGene: Rn.45686 EntrezGene: 113912 Ensembl Chr11: 84839082 - 84840482 Strand: -1 GO terms: 0004872 0005515 0005783 0005886 0007409 0048503 |
Design | SiRNA + |
Name | NgR-3 , NgR3 + |
Sequence | siRNA sense (21b) TCAGCTCACTGATGAGGAGTT / siRNA antisense (21b) CTCCTCATCAGTGAGCTGATT |
Target | Rtn4r ( Rattus norvegicus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:18 + |
hide properties that link here |
No properties link to this page. |