Browse wiki
Sequence 1114(cSema6D) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Sema domain, transmembrane domain ( TM ), … Sema domain, transmembrane domain ( TM ), and cytoplasmic domain, ( semaphorin ) 6D Ensembl: ENSG00000137872 UniGene: Hs.511265 EntrezGene: 80031 Ensembl Chr15: 45797978 - 45853709 Strand: 1 GO terms: 0004866 0004872 0005737 0007275 0007399 0016020 0016021 003015437 0007275 0007399 0016020 0016021 0030154 |
Design | SiRNA + |
Name | cSema6D + |
Sequence | siRNA sense (21b) GCAGGAAATTAACATGGAGTT / siRNA antisense (21b) CTCCATGTTAATTTCCTGCTT |
Target | SEMA6D ( Gallus gallus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:21 + |
hide properties that link here |
No properties link to this page. |