Browse wiki

Jump to: navigation, search
Sequence 1118(SETDB1-2 , SETDB12)
Application Gene silencing +
Chemistry RNA +
Description SET domain, bifurcated 1 Ensembl: ENSG00000133321 UniGene: Hs.643565 EntrezGene: 9869 Ensembl Chr11: 63060856 - 63070505 Strand: 1 GO terms: 8288
Design ShRNA +
Name SETDB1-2 , SETDB12  +
Sequence (47b) GATGTGAGTGGATCTATCGTTCAAGAGACGATAGATCCACTCACATC
Target SETDB1 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:02  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders