Browse wiki

Jump to: navigation, search
Sequence 111 (CLSTR05630r1 cieg008h18 129)
Application Gene silencing +
Chemistry PmGpmCpmGpmGpmCpmCpmCpmApmTpmCpmTpmTpmCpmTpmGpmTpmTpmCpmApmCpmTpmApmTpmTpmT +
Design Morpholino +
Name CLSTR05630r1_cieg008h18_129  +
Sequence (25b) GCGGCCCATCTTCTGTTCACTATTT
Target AK115209 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:40  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence_111_(CLSTR05630r1_cieg008h18_129)"