Browse wiki

Jump to: navigation, search
Sequence 1120(siSFN.2)
Application Gene silencing +
Chemistry RNA +
Description Stratifin Ensembl: ENSG00000175793 UniGene: Hs.523718 EntrezGene: 2810 Ensembl Chr1: 27062240 - 27063534 Strand: 1 GO terms: 0000074 0000079 0001836 0005615 0005737 0006469 0007165 0008283 0008426 0008630 0008632 0019904 0030216 0043154 0043588
Design SiRNA +
Name siSFN.2  +
Sequence siRNA sense (21b) GGGAGAAGGTGGAGACTGATT / siRNA antisense (21b) TCAGTCTCCACCTTCTCCCGG
Target SFN (Homo sapiens) +
Categories Sequence  +
Modification┬ádateThis property is a special property in this wiki. 2 March 2015 02:21:11  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders