Browse wiki
Sequence 1120(siSFN.2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Stratifin Ensembl: ENSG00000175793 UniGene: Hs.523718 EntrezGene: 2810 Ensembl Chr1: 27062240 - 27063534 Strand: 1 GO terms: 0000074 0000079 0001836 0005615 0005737 0006469 0007165 0008283 0008426 0008630 0008632 0019904 0030216 0043154 0043588 |
Design | SiRNA + |
Name | siSFN.2 + |
Sequence | siRNA sense (21b) GGGAGAAGGTGGAGACTGATT / siRNA antisense (21b) TCAGTCTCCACCTTCTCCCGG |
Target | SFN (Homo sapiens) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:11 + |
hide properties that link here |
No properties link to this page. |