Browse wiki
| Sequence 1125(S2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | S-phase kinase-associated protein 2 ( p45 ) Ensembl: ENSG00000145604 UniGene: Hs.23348 EntrezGene: 6502 Ensembl Chr5: 36187946 - 36219902 Strand: 1 GO terms: 0000074 0000082 0005515 0006512 0008283 |
| Design | ShRNA + |
| Name | S2 + |
| Sequence | (56b) CACCATCAGATCTCTCTACTTTATTCAAGAGATAAAGTAGAGAGATCTGATTTTTT |
| Target | SKP2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:22 + |
| hide properties that link here |
| No properties link to this page. |
