Browse wiki

Jump to: navigation, search
Sequence 1130(siSMAD2.2)
Application Gene silencing +
Chemistry RNA +
Description SMAD family member 2 Ensembl: ENSG0000017 … SMAD family member 2 Ensembl: ENSG00000175387 UniGene: Hs.12253 EntrezGene: 4087 Ensembl Chr18: 43613464 - 43710924 Strand: -1 GO terms: 0001707 0003690 0005622 0005634 0005667 0005737 0006350 0006355 0007179 0007242 0008134 0009952 0016563 0045165 0045944 0048340 005109852 0016563 0045165 0045944 0048340 0051098
Design SiRNA +
Name siSMAD2.2  +
Sequence siRNA sense (21b) ACTAGAATGTGCACCATAATT / siRNA antisense (21b) TTATGGTGCACATTCTAGTTA
Target SMAD2 (Homo sapiens) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 2 March 2015 02:20:57  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders