Browse wiki
| Sequence 1139(SMG6) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Smg-6 homolog, nonsense mediated mRNA deca … Smg-6 homolog, nonsense mediated mRNA decay factor ( C. elegans ) Ensembl: ENSG00000070366 UniGene: Hs.448342 EntrezGene: 23293 Ensembl Chr17: 1909883 - 2153819 Strand: -1 GO terms: 0000184 0000723 0000781 0003677 0004519 0005515 0005634 0005694 0005697 0005737 0006406 0016787 0030145 0035303 0042162 004687206 0016787 0030145 0035303 0042162 0046872 |
| Design | SiRNA + |
| Name | SMG6 + |
| Sequence | siRNA sense (21b) AAGCCAGTGATACAGCGAATT / siRNA antisense (21b) TTCGCTGTATCACTGGCTTTT |
| Target | SMG6 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:08 + |
| hide properties that link here |
| No properties link to this page. |
