Browse wiki

Jump to: navigation, search
Sequence 1139(SMG6)
Application Gene silencing +
Chemistry RNA +
Description Smg-6 homolog, nonsense mediated mRNA deca … Smg-6 homolog, nonsense mediated mRNA decay factor ( C. elegans ) Ensembl: ENSG00000070366 UniGene: Hs.448342 EntrezGene: 23293 Ensembl Chr17: 1909883 - 2153819 Strand: -1 GO terms: 0000184 0000723 0000781 0003677 0004519 0005515 0005634 0005694 0005697 0005737 0006406 0016787 0030145 0035303 0042162 004687206 0016787 0030145 0035303 0042162 0046872
Design SiRNA +
Name SMG6  +
Sequence siRNA sense (21b) AAGCCAGTGATACAGCGAATT / siRNA antisense (21b) TTCGCTGTATCACTGGCTTTT
Target SMG6 ( Homo sapiens ) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 2 March 2015 02:21:08  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders