Browse wiki
| Sequence 1 (H1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | "HIV-1 Rev binding protein / ArfGAP with F … "HIV-1 Rev binding protein / ArfGAP with FG repeats 1 Ensembl: ENSG00000173744 UniGene: Hs.591619 , Hs.595484 , Hs.694029 EntrezGene: 5175 Ensembl Chr2: 228045286 - 228130548 Strand: 1 GO terms: 0003677 0003723 0005515 0005634 0005643 0006406 0006810 0007275 0007283 0008270 0030154 0031410 0043087 0046872 " 0008270 0030154 0031410 0043087 0046872 " |
| Design | SiRNA + |
| Name | H1 + |
| Sequence | siRNA sense (21b) CAGCCCAATGGTGCAGGTTTT / siRNA antisense (21b) AACCTGCACCATTGGGCTGTT |
| Target | AGFG1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 7 May 2015 14:52:59 + |
| hide properties that link here |
| No properties link to this page. |
