Browse wiki
| Sequence 1 (Mipomersen , ISIS 301012 , ISIS-301012 , Kynamro) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoG*moC*moC*moU*moC*A*G*T*C*T*G*C*T*T*C*moG*moC*moA*moC*moC + |
| Description | Apolipoprotein B (including Ag(x) antigen) … Apolipoprotein B (including Ag(x) antigen) Ensembl: ENSG00000084674 UniGene: Hs.120759 EntrezGene: 603 Ensembl Chr2: 21077806 - 21120450 Strand: -1 GO terms: 0005102 0005319 0005576 0005625 0005783 0005792 0006629 0006642 0006869 0007165 0008015 0008201 0008202 0008203 0030301 004262715 0008201 0008202 0008203 0030301 0042627 |
| Design | MOE gapmer + |
| Name | Mipomersen , ISIS 301012 , ISIS-301012 , Kynamro + |
| Sequence | GCCTCAGTCTGCTTCGCACC |
| Target | APOB ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 31 July 2015 10:44:06 + |
| hide properties that link here |
| No properties link to this page. |
