Sequence 1040(PKACb)
From Wikisequences
Sequence PKACb | |
---|---|
Target | Prkacb ( Mus musculus ) |
Description | Protein kinase, cAMP dependent, catalytic, beta
Ensembl: ENSMUSG00000005034 UniGene: Mm.16766 EntrezGene: 18749 Ensembl Chr3: 146392544 - 146475894 Strand: -1 GO terms: 0000166 0000287 0004672 0004674 0004691 0004713 0005524 0005634 0005737 0005952 0006468 0007188 0016740 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GAGTTTCTAGCCAAAGCCATT / siRNA antisense (21b) TGGCTTTGGCTAGAAACTCTT |
Application | gene silencing |
Name | PKACb |
References
Protein kinase A blocks Raf-1 activity by stimulating 14-3-3 binding and blocking Raf-1 interaction with Ras.Dumaz N, Marais R.J Biol Chem. 2003 Aug 8;278(32) :29819-23. Epub 2003 Jun 11.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478