Sequence 1058(Raldh2-1 , Raldh21)
From Wikisequences
| Sequence Raldh2-1 , Raldh21 | |
|---|---|
| Target | Raldh2 ( Gallus gallus ) |
| Description | |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CAGGAGAGCAGATCTGTGATT / siRNA antisense (21b) TCACAGATCTGCTCTCCTGTT |
| Application | gene silencing |
| Name | Raldh2-1 , Raldh21 |
References
In vivo comparative study of RNAi methodologies by in ovo electroporation in the chick embryo.Rao M, Baraban JH, Rajaii F, Sockanathan S.Dev Dyn. 2004 Nov;231(3) :592-600.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
