Sequence 1058(Raldh2-1 , Raldh21)

From Wikisequences
Jump to: navigation, search
Sequence Raldh2-1 , Raldh21
Target Raldh2 ( Gallus gallus )
Description
Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) CAGGAGAGCAGATCTGTGATT / siRNA antisense (21b) TCACAGATCTGCTCTCCTGTT
Application gene silencing
Name Raldh2-1 , Raldh21

References

In vivo comparative study of RNAi methodologies by in ovo electroporation in the chick embryo.Rao M, Baraban JH, Rajaii F, Sockanathan S.Dev Dyn. 2004 Nov;231(3) :592-600. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders