Sequence 1070(siRb1-4 , siRb14)
Sequence siRb1-4 , siRb14 | |
---|---|
Target | RB1 ( Homo sapiens ) |
Description | Retinoblastoma 1 ( including osteosarcoma )
Ensembl: ENSG00000139687 UniGene: Hs.408528 EntrezGene: 5925 Ensembl Chr13: 47775884 - 47954027 Strand: 1 GO terms: 0000075 0000082 0000122 0000279 0000785 0003700 0003713 0005515 0005634 0005667 0005819 0006350 0006469 0007049 0007050 0008134 0008285 0016564 0016568 0016605 0019900 0030308 0030521 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) ACTCTCACCTCCCATGTTGTT / siRNA antisense (21b) CAACATGGGAGGTGAGAGTTT |
Application | gene silencing |
Name | siRb1-4 , siRb14 |
References
Specificity of short interfering RNA determined through gene expression signatures.Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW.Proc Natl Acad Sci U S A. 2003 May 27;100(11) :6347-52. Epub 2003 May 13.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
