Sequence 1084(siRHOA.2)
Sequence siRHOA.2 | |
---|---|
Target | RHOA (Homo sapiens) |
Description | Ras homolog gene family, member A
Ensembl: ENSG00000067560 UniGene: Hs.247077 EntrezGene: 387 Ensembl Chr3: 49371585 - 49424530 Strand: -1 GO terms: 0000166 0000287 0003924 0004871 0005515 0005525 0005622 0005737 0005856 0006886 0006913 0007165 0007264 0007266 0015031 0016020 0030036 0042346 0043123 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) AGCTAGACGTGGGAAGAAATT / siRNA antisense (21b) TTTCTTCCCACGTCTAGCTTG |
Application | gene silencing |
Name | siRHOA.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
