Sequence 108 (CLSTR12925r1 cilv027n13 178)

From Wikisequences
Jump to: navigation, search
Sequence CLSTR12925r1_cilv027n13_178
Target AK115091 ( Ciona intestinalis )
Description
Design morpholino
Chemistry pmGpmApmTpmCpmApmGpmGpmCpmTpmCpmCpmApmCpmApmGpmCpmApmCpmApmGpmTpmTpmCpmApmT
Sequence (25b) GATCAGGCTCCACAGCACAGTTCAT
Application gene silencing
Name CLSTR12925r1_cilv027n13_178

References

Morpholino-based gene knockdown screen of novel genes with developmental function in Ciona intestinalis.Yamada L, Shoguchi E, Wada S, Kobayashi K, Mochizuki Y, Satou Y, Satoh N.Development. 2003 Dec;130(26) :6485-95. Epub 2003 Nov 19. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders