Sequence 1127(SLC27A2-Like2-2)

From Wikisequences
Jump to: navigation, search
Sequence SLC27A2-Like2-2
Target SLC27A2-Like2-2 ( Danio rerio )
Description
Design morpholino
Chemistry pmApmGpmGpmTpmGpmTpmCpmApmCpmTpmTpmTpmGpmTpmTpmTpmCpmGpmGpmCpmTpmGpmApmTpmT
Sequence (25b) AGGTGTCACTTTGTTTCGGCTGATT
Application gene silencing
Name SLC27A2-Like2-2

References

Genome-wide reverse genetics framework to identify novel functions of the vertebrate secretome.Pickart MA, Klee EW, Nielsen AL, Sivasubbu S, Mendenhall EM, Bill BR, Chen E, Eckfeldt CE, Knowlton M, Robu ME, Larson JD, Deng Y, Schimmenti LA, Ellis LB, Verfaillie CM, Hammerschmidt M, Farber SA, Ekker SC.PLoS One. 2006 Dec 20;1:e104. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders