Sequence 1127(SLC27A2-Like2-2)
From Wikisequences
| Sequence SLC27A2-Like2-2 | |
|---|---|
| Target | SLC27A2-Like2-2 ( Danio rerio ) |
| Description | |
| Design | morpholino |
| Chemistry | pmApmGpmGpmTpmGpmTpmCpmApmCpmTpmTpmTpmGpmTpmTpmTpmCpmGpmGpmCpmTpmGpmApmTpmT |
| Sequence | (25b) AGGTGTCACTTTGTTTCGGCTGATT |
| Application | gene silencing |
| Name | SLC27A2-Like2-2 |
References
Genome-wide reverse genetics framework to identify novel functions of the vertebrate secretome.Pickart MA, Klee EW, Nielsen AL, Sivasubbu S, Mendenhall EM, Bill BR, Chen E, Eckfeldt CE, Knowlton M, Robu ME, Larson JD, Deng Y, Schimmenti LA, Ellis LB, Verfaillie CM, Hammerschmidt M, Farber SA, Ekker SC.PLoS One. 2006 Dec 20;1:e104.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
