Sequence 1141(CNX9a)

From Wikisequences
Jump to: navigation, search
Sequence CNX9a
Target SNX9 ( Homo sapiens )
Description Sorting nexin 9

Ensembl: ENSG00000130340 UniGene: Hs.191213 EntrezGene: 51429 Ensembl Chr6: 158164282 - 158286097 Strand: 1 GO terms: 0005070 0005515 0005625 0005737 0005792 0005886 0006886 0007154 0008104 0035091

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) GAGAGTCAGCATCATGTCTTT / siRNA antisense (21b) AGACATGATGCTGACTCTCTT
Application gene silencing
Name CNX9a

References

Regulated membrane recruitment of dynamin-2 mediated by sorting nexin 9.Lundmark R, Carlsson SR.J Biol Chem. 2004 Oct 8;279(41) :42694-702. Epub 2004 Aug 6. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Description. Members of the sorting nexin protein family, such as SNX9, contain a phospholipid-binding module called the phox homology (PX) domain. SNX9 functions in clathrin (see 118955)-mediated endocytosis and clathrin-independent, actin (see 102610)-dependent fluid-phase endocytosis (Yarar et al., 2007). Gene Function. Howard et al. (1999) determined that binding of the SH3 domain of SNX9 to ADAM9 and ADAM15 required the C-terminal proline-rich region of the ADAM9 and ADAM15 cytoplasmic tails. Both SNX9 and SH3GL2 preferentially bound the precursors, but not the processed forms, of ADAM9 and ADAM15.

Using green monkey kidney cells, Yarar et al. (2007) showed that SNX9 was required for clathrin-independent, actin-dependent fluid-phase endocytosis. SNX9 directly regulated F-actin nucleation through N-WASP (WASL; 605056) and the ARP2 (ACTR2; 604221)/ARP3 (ACTR3; 604222) complex, and this activity was synergistically enhanced by phosphatidylinositol(4,5)bisphosphate-containing liposomes. Yarar et al. (2007) concluded that SNX9 physically couples F-actin nucleation to plasma membrane remodeling during endocytosis.

Posor et al. (2013) showed that the BAR domain protein SNX9 is a phosphatidylinositol-3,4-bisphosphate (PI(3,4)P2) effector at clathrin-coated pits in clathrin-mediated endocytosis. Timed formation of PI(3,4)P2 by class 2 phosphatidylinositol-3-kinase C2A (PI3KC2A; 603601) is required for selective enrichment of SNX9 at late-stage endocytic intermediates.

Support Doctors Without Borders