Sequence 1145(SOD1i-2 , SOD1i2)
Sequence SOD1i-2 , SOD1i2 | |
---|---|
Target | Sod1 ( Rattus norvegicus ) |
Description | Superoxide dismutase 1, soluble ( amyotrophic lateral sclerosis 1 ( adult ) )
Ensembl: ENSG00000142168 UniGene: Hs.443914 EntrezGene: 6647 Ensembl Chr21: 31953806 - 31963115 Strand: 1 GO terms: 0000187 0000303 0001541 0001819 0001890 0001895 0002262 0004785 0005507 0005615 0005634 0005737 0005739 0005759 0005777 0005829 0005886 0006302 0006309 0006749 0006801 0006879 0006916 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CCAGTGGTGGTGTCAGGACTT / siRNA antisense (21b) GTCCTGACACCACCACTGGTT |
Application | gene silencing |
Name | SOD1i-2 , SOD1i2 |
References
Highly efficient small interfering RNA delivery to primary mammalian neurons induces MicroRNA-like effects before mRNA degradation.Davidson TJ, Harel S, Arboleda VA, Prunell GF, Shelanski ML, Greene LA, Troy CM.J Neurosci. 2004 Nov 10;24(45) :10040-6. J Neurosci. 2005 Feb 2;25(5) :1311.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478