Sequence 1147(siSOS1.1)
Sequence siSOS1.1 | |
---|---|
Target | SOS1 (Homo sapiens) |
Description | Son of sevenless homolog 1 (Drosophila)
Ensembl: ENSG00000115904 UniGene: Hs.654397 EntrezGene: 6654 Ensembl Chr2: 39062206 - 39201095 Strand: -1 GO terms: 0000786 0003677 0005085 0005089 0005100 0005515 0005622 0005634 0005886 0006334 0007001 0007165 0007264 0007265 0014069 0017124 0035023 0043025 0045742 0048011 0051056 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGTTGAATCCATCACTAAATT / siRNA antisense (21b) TTTAGTGATGGATTCAACCCA |
Application | gene silencing |
Name | siSOS1.1 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478