Sequence 1148(Sp100i-707 , Sp100i707)
From Wikisequences
Sequence Sp100i-707 , Sp100i707 | |
---|---|
Target | SP100 ( Homo sapiens ) |
Description | SP100 nuclear antigen
Ensembl: ENSG00000067066 UniGene: Hs.369056 EntrezGene: 6672 Ensembl Chr2: 230989225 - 231116043 Strand: 1 GO terms: 0000785 0003677 0005488 0005515 0005634 0005694 0006355 0008270 0016605 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GATGATTCGCTAGGAAGCCTT / siRNA antisense (21b) GGCTTCCTAGCGAATCATCTT |
Application | gene silencing |
Name | Sp100i-707 , Sp100i707 |
References
Iterative microarray and RNA interference-based interrogation of the SRC-induced invasive phenotype.Irby RB, Malek RL, Bloom G, Tsai J, Letwin N, Frank BC, Verratti K, Yeatman TJ, Lee NH.Cancer Res. 2005 Mar 1;65(5) :1814-21.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478