Sequence 1149(SPPL2b-1)

Sequence SPPL2b-1
Target	SPPL2b ( Danio rerio )
Description
Design	morpholino
Chemistry	pmCpmApmTpmGpmApmTpmGpmCpmCpmTpmGpmApmTpmTpmGpmTpmTpmGpmTpmGpmApmTpmCpmTpmC
Sequence	(25b) CATGATGCCTGATTGTTGTGATCTC
Application	gene silencing
Name	SPPL2b-1

References

Genome-wide reverse genetics framework to identify novel functions of the vertebrate secretome.Pickart MA, Klee EW, Nielsen AL, Sivasubbu S, Mendenhall EM, Bill BR, Chen E, Eckfeldt CE, Knowlton M, Robu ME, Larson JD, Deng Y, Schimmenti LA, Ellis LB, Verfaillie CM, Hammerschmidt M, Farber SA, Ekker SC.PLoS One. 2006 Dec 20;1:e104.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background