Sequence 1152(siSRP54c)
From Wikisequences
Sequence siSRP54c | |
---|---|
Target | SRP54 ( Homo sapiens ) |
Description | Signal recognition particle 54kDa
Ensembl: ENSG00000054219 UniGene: Hs.167535 EntrezGene: 6729 Ensembl Chr2: 160368122 - 160469493 Strand: -1 GO terms: 0004872 0005529 0005887 0006897 0006954 0006955 0016020 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GAAATGAACAGGAGTCAATTT / siRNA antisense (21b) ATTGACTCCTGTTCATTTCTT |
Application | gene silencing |
Name | siSRP54c |
References
Differential regulation of the TRAIL death receptors DR4 and DR5 by the signal recognition particle.Ren YG, Wagner KW, Knee DA, Aza-Blanc P, Nasoff M, Deveraux QL.Mol Biol Cell. 2004 Nov;15(11) :5064-74. Epub 2004 Sep 8.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478