Sequence 1161(SSU05 0074)
From Wikisequences
Sequence SSU05_0074 | |
---|---|
Target | SSU05_0074 ( Streptococcus suis ) |
Description | |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (22b) ACGGTGGTGGTGAAGGTAAAGC / Reverse PCR primer (23b) TGGTTGCGACGACGAACGATAAG |
Application | gene expression |
Name | SSU05_0074 |
References
Effect of licochalcone A on growth and properties of Streptococcus suis.Hao H, Hui W, Liu P, Lv Q, Zeng X, Jiang H, Wang Y, Zheng X, Zheng Y, Li J, Zhou X, Jiang Y.PLoS One. 2013 Jul 23;8(7) :e67728. doi: 10.1371/journal.pone.0067728. Print 2013. PLoS One. 2013;8(7) . doi:10.1371/annotation/59a7568c-915d-4d9c-b912-f93af72acdcb.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478