Sequence 1167(SSU05 0089)

From Wikisequences
Jump to: navigation, search
Sequence SSU05_0089
Target SSU05_0089 ( Streptococcus suis )
Description
Design primer set
Chemistry DNA
Sequence Forward PCR primer (21b) GTGGTACATCATCAGGTAACG / Reverse PCR primer (19b) GGAAGACGACGGAACAATG
Application gene expression
Name SSU05_0089

References

Effect of licochalcone A on growth and properties of Streptococcus suis.Hao H, Hui W, Liu P, Lv Q, Zeng X, Jiang H, Wang Y, Zheng X, Zheng Y, Li J, Zhou X, Jiang Y.PLoS One. 2013 Jul 23;8(7) :e67728. doi: 10.1371/journal.pone.0067728. Print 2013. PLoS One. 2013;8(7) . doi:10.1371/annotation/59a7568c-915d-4d9c-b912-f93af72acdcb.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders