Sequence 1177(siRNA-1 , siRNA1)
From Wikisequences
| Sequence siRNA-1 , siRNA1 | |
|---|---|
| Target | SUGT1 ( Homo sapiens ) |
| Description | SGT1, suppressor of G2 allele of SKP1 ( S. cerevisiae )
Ensembl: ENSG00000074803 UniGene: Hs.281902 EntrezGene: 10910 Ensembl Chr15: 46285791 - 46383567 Strand: 1 GO terms: 0004413 0005215 0005515 0005524 0005624 0005886 0006566 0006810 0006811 0006813 0006814 0006821 0006835 0008152 0008511 0015293 0015377 0016020 0016021 0016740 0017153 0030955 0031402 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GAAAGGTAATTATGTGGTGTT / siRNA antisense (21b) CACCACATAATTACCTTTCTT |
| Application | gene silencing |
| Name | siRNA-1 , siRNA1 |
References
RNA interference against a glioma-derived allele of EGFR induces blockade at G2M.Fan QW, Weiss WA.Oncogene. 2005 Jan 27;24(5) :829-37.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
