Sequence 1178(b3a2 1)

Sequence b3a2_1
Target	SUGT1 ( Homo sapiens )
Description	SGT1, suppressor of G2 allele of SKP1 ( S. cerevisiae ) Ensembl: ENSG00000074803 UniGene: Hs.281902 EntrezGene: 10910 Ensembl Chr15: 46285791 - 46383567 Strand: 1 GO terms: 0004413 0005215 0005515 0005524 0005624 0005886 0006566 0006810 0006811 0006813 0006814 0006821 0006835 0008152 0008511 0015293 0015377 0016020 0016021 0016740 0017153 0030955 0031402
Design	shRNA
Chemistry	RNA
Sequence	(64b) GATCCCGCAGAGTTCAAAAGCCCTTTTCAAGAGAAAGGGCTTTTGAACTCTGCTTTTTTGGAAG
Application	gene silencing
Name	b3a2_1

References

Stable RNA interference (RNAi)as an option for anti-bcr-abl therapy.Scherr M, Battmer K, Schultheis B, Ganser A, Eder M.Gene Ther. 2005 Jan;12(1) :12-21.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background