Sequence 1193(H/M A20)
Sequence H/M A20 | |
---|---|
Target | Tnfaip3 ( Mus musculus ) |
Description | Tumor necrosis factor, alpha-induced protein 3
Ensembl: ENSG00000119684 UniGene: Hs.591338 EntrezGene: 7128 Ensembl Chr14: 74550220 - 74587988 Strand: -1 GO terms: 0000793 0000795 0003682 0003696 0005515 0005524 0005634 0005712 0006298 0006974 0007130 0007131 0007140 0007144 0008104 0019237 0030983 |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (23b) CCTCTTCTTCGCCTGCTTTGTCC / Reverse PCR primer (23b) CCCCGTCACCAAGCCGTTGTACC |
Application | gene expression |
Name | H/M A20 |
References
Molecular biomarkers of vascular dysfunction in obstructive sleep apnea.Kaczmarek E, Bakker JP, Clarke DN, Csizmadia E, Kocher O, Veves A, Tecilazich F, O'Donnell CP, Ferran C, Malhotra A.PLoS One. 2013 Jul 29;8(7) :e70559. doi: 10.1371/journal.pone.0070559. Print 2013.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478