Sequence 1195(TNFR2)
From Wikisequences
Sequence TNFR2 | |
---|---|
Target | TNFRSF1B ( Homo sapiens ) |
Description | Tumor necrosis factor receptor superfamily, member 1B
Ensembl: ENSG00000028137 UniGene: Hs.256278 EntrezGene: 7133 Ensembl Chr1: 12149647 - 12191863 Strand: 1 GO terms: 0004872 0004888 0005031 0005515 0006915 0006954 0006955 0007165 0007166 0008219 0016020 0016021 0019221 0050728 0050779 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CAGAACCGCATCTGCACCTTT / siRNA antisense (21b) AGGTGCAGATGCGGTTCTGTT |
Application | gene silencing |
Name | TNFR2 |
References
Identification of cell surface targets for HIV-1 therapeutics using genetic screens.Dunn SJ, Khan IH, Chan UA, Scearce RL, Melara CL, Paul AM, Sharma V, Bih FY, Holzmayer TA, Luciw PA, Abo A.Virology. 2004 Apr 10;321(2) :260-73.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478