Sequence 1199(p53)
Sequence p53 | |
---|---|
Target | TP53 ( Homo sapiens ) |
Description | Tumor protein p53 ( Li-Fraumeni syndrome )
Ensembl: ENSG00000141510 UniGene: Hs.654481 EntrezGene: 7157 Ensembl Chr17: 7512445 - 7531642 Strand: -1 GO terms: 0000060 0000739 0001701 0001836 0003677 0003700 0004518 0005507 0005515 0005524 0005626 0005634 0005654 0005657 0005730 0005737 0005739 0005783 0005829 0006284 0006289 0006350 0006355 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CTACTTCCTGAAAACAACGTT / siRNA antisense (21b) CGTTGTTTTCAGGAAGTAGTT |
Application | gene silencing |
Name | p53 |
References
Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells.Scacheri PC, Rozenblatt-Rosen O, Caplen NJ, Wolfsberg TG, Umayam L, Lee JC, Hughes CM, Shanmugam KS, Bhattacharjee A, Meyerson M, Collins FS.Proc Natl Acad Sci U S A. 2004 Feb 17;101(7) :1892-7. Epub 2004 Feb 9.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478