Sequence 1200(p53)
| Sequence p53 | |
|---|---|
| Target | TP53 ( Homo sapiens ) |
| Description | Tumor protein p53 ( Li-Fraumeni syndrome )
Ensembl: ENSG00000141510 UniGene: Hs.654481 EntrezGene: 7157 Ensembl Chr17: 7512445 - 7531642 Strand: -1 GO terms: 0000060 0000739 0001701 0001836 0003677 0003700 0004518 0005507 0005515 0005524 0005626 0005634 0005654 0005657 0005730 0005737 0005739 0005783 0005829 0006284 0006289 0006350 0006355 |
| Design | shRNA |
| Chemistry | RNA |
| Sequence | (49b) GACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTGGAGTCTT |
| Application | gene silencing |
| Name | p53 |
References
The tumor-suppressive functions of the human INK4A locus.Voorhoeve PM, Agami R.Cancer Cell. 2003 Oct;4(4) :311-9.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
The transcription factor p53 responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. In addition, p53 appears to induce apoptosis through nontranscriptional cytoplasmic processes. In unstressed cells, p53 is kept inactive essentially through the actions of the ubiquitin ligase MDM2 (164785), which inhibits p53 transcriptional activity and ubiquitinates p53 to promote its degradation. Numerous posttranslational modifications modulate p53 activity, most notably phosphorylation and acetylation. Several less abundant p53 isoforms also modulate p53 activity. Activity of p53 is ubiquitously lost in human cancer either by mutation of the p53 gene itself or by loss of cell signaling upstream or downstream of p53 (Toledo and Wahl, 2006; Bourdon, 2007; Vousden and Lane, 2007).
