Sequence 1202(siTP53.2)
| Sequence siTP53.2 | |
|---|---|
| Target | TP53 (Homo sapiens) |
| Description | Tumor protein p53 (Li-Fraumeni syndrome)
Ensembl: ENSG00000141510 UniGene: Hs.654481 EntrezGene: 7157 Ensembl Chr17: 7512445 - 7531642 Strand: -1 GO terms: 0000060 0000739 0001701 0001836 0003677 0003700 0004518 0005507 0005515 0005524 0005626 0005634 0005654 0005657 0005730 0005737 0005739 0005783 0005829 0006284 0006289 0006350 0006355 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GAGTGCATTGTGAGGGTTATT / siRNA antisense (21b) TAACCCTCACAATGCACTCTG |
| Application | gene silencing |
| Name | siTP53.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
