Sequence 1204(P53BP1 2 , P53BP12)

Sequence P53BP1_2 , P53BP12
Target	TP53BP1 ( Homo sapiens )
Description	Tumor protein p53 binding protein 1 Ensembl: ENSG00000067369 UniGene: Hs.440968 EntrezGene: 7158 Ensembl Chr15: 41486699 - 41590028 Strand: -1 GO terms: 0000776 0003676 0003677 0003684 0005515 0005622 0005634 0005654 0005657 0005737 0006281 0006350 0016563 0045893
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GATACTCCTTGCCTGATAATT / siRNA antisense (21b) TTATCAGGCAAGGAGTATCTT
Application	gene silencing
Name	P53BP1_2 , P53BP12

References

Human Rif1, ortholog of a yeast telomeric protein, is regulated by ATM and 53BP1 and functions in the S-phase checkpoint.Silverman J, Takai H, Buonomo SB, Eisenhaber F, de Lange T.Genes Dev. 2004 Sep 1;18(17) :2108-19.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Iwabuchi et al. (1994) showed that TP53BP1 binds to the conformationally sensitive central domain of wildtype p53 (191170) but not to mutant p53 in vitro. Iwabuchi et al. (1994) also demonstrated that TP53BP1 and TP53BP2 (602143) do not bind to the C-terminal oligomerization domain or the N-terminal transcriptional activation domain of p53.

Immunoblot analysis by Iwabuchi et al. (1998) showed that expression of TP53BP1 or TP53BP2 enhances the transactivation function of p53 and induces the expression of p21 (CDKN1A; 116899).

Wang et al. (2002) used small interfering RNA directed against TP53BP1 in mammalian cells to demonstrate that TP53BP1 is a key transducer of the DNA damage checkpoint signal. TP53BP1 was required for p53 accumulation, G2/M checkpoint arrest, and the intra-S-phase checkpoint in response to ionizing radiation. TP53BP1 played a partially redundant role in phosphorylation of the downstream checkpoint effector proteins BRCA1 and CHK2 (604373) but was required for the formation of BRCA1 foci in a hierarchical branched pathway for the recruitment of repair and signaling proteins to sites of DNA damage.

DiTullio et al. (2002) demonstrated that 53BP1 also regulates ATM (607585)-dependent phosphorylation events in response to ionizing radiation.

Dimitrova et al. (2008) showed that 53BP1 changes the dynamic behavior of chromatin to promote DNA repair. They used conditional deletion of the shelterin component TRF2 (602027) from mouse cells to deprotect telomeres, which, like double-strand breaks, activate the ATM kinase, accumulate 53BP1, and are processed by nonhomologous end joining (NHEJ). Deletion of TRF2 from 53BP1-deficient cells established that NHEJ of dysfunctional telomeres is strongly dependent on the binding of 53BP1 to damaged chromosome ends. To address the mechanism by which 53BP1 promotes NHEJ, Dimitrova et al. (2008) used time-lapse microscopy to measure telomere dynamics before and after their deprotection. Imaging showed that deprotected telomeres are more mobile and sample larger territories within the nucleus. This change in chromatin dynamics was dependent on 53BP1 and ATM but did not require a functional NHEJ pathway. Dimitrova et al. (2008) proposed that binding of 53BP1 near DNA breaks changes the dynamic behavior of the local chromatin, thereby facilitating NHEJ repair reactions that involve distant sites, including joining of dysfunctional telomeres and activation-induced cytodine deaminase (AID; 605257)-induced breaks in immunoglobulin class-switch recombination. Animal Model.Manis et al. (2004) generated mice deficient in 53bp1 and showed that the protein was dispensable for V(D)J recombination and somatic hypermutation in B lymphocytes, but it was critical for Igh class switch recombination of constant region genes. Manis et al. (2004) proposed that 53BP1 is involved in the DNA damage response to double-stranded breaks.