Sequence 1205(p73)

Sequence p73
Target	TP73 ( Homo sapiens )
Description	Tumor protein p73 Ensembl: ENSG00000078900 UniGene: Hs.697294 EntrezGene: 7161 Ensembl Chr1: 3558989 - 3639716 Strand: 1 GO terms: 0003677 0003700 0005515 0005634 0006298 0006350 0006355 0006915 0007049 0008270 0008630 0045786 0045893 0046872
Design	shRNA
Chemistry	RNA
Sequence	(63b) GATCCCCGCCGGGGGAATAATGAGGTTTCAAGAGAACCTCATTATTCCCCCGGCTTTTGGAAA
Application	gene silencing
Name	p73

References

ASPP1 and ASPP2: common activators of p53 family members.Bergamaschi D, Samuels Y, Jin B, Duraisingham S, Crook T, Lu X.Mol Cell Biol. 2004 Feb;24(3) :1341-50.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background