Sequence 1207()
Sequence | |
---|---|
Target | TPT1 ( Homo sapiens ) |
Description | Tumor protein, translationally-controlled 1
Ensembl: ENSG00000133112 UniGene: Hs.374596 EntrezGene: 7178 Ensembl Chr13: 44809008 - 44813347 Strand: -1 GO terms: 0005509 0005515 0005615 0005737 0005771 0006816 0006874 0006916 0042981 0045298 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGTACCGAAAGCACAGTAATT / siRNA antisense (21b) TTACTGTGCTTTCGGTACCTT |
Application | gene silencing |
Name |
References
Biological models and genes of tumor reversion: cellular reprogramming through tpt1/TCTP and SIAH-1.Tuynder M, Susini L, Prieur S, Besse S, Fiucci G, Amson R, Telerman A.Proc Natl Acad Sci U S A. 2002 Nov 12;99(23) :14976-81. Epub 2002 Oct 24.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. MacDonald et al. (1995) showed that both human and mouse recombinant HRF proteins caused histamine release from human basophils of a subpopulation of donors, and this release was dependent on IgE. Polyclonal antibodies raised in the rabbit against recombinant mouse Hrf recognized and removed the biologic activity of both recombinant and native HRF. HRF identifies heterogeneity of IgE, which may be a genetically determined polymorphism, may be due to differential glycosylation of the IgE molecule, or may be based on interactions with the alternatively spliced forms of human IgE reported to be present in human atopic serum (Zhang et al., 1992; see 147180).
Amzallag et al. (2004) found that secretion of TPT1 proceeded by a nonclassical pathway independent of the endoplasmic reticulum and Golgi apparatus. Secreted TPT1 appeared to originate from preexisting pools. Amzallag et al. (2004) determined that TSAP6 (STEAP3; 609671) interacted with TPT1 in several protein interaction assays, and the 2 proteins codistributed to small vesicles called exosomes at the plasma membrane and around the nucleus in several human cell lines. Overexpression of TSAP6 increased the level of TPT1 in exosome preparations and consistently enhanced TPT1 secretion.
Hsu et al. (2007) demonstrated that a conserved protein, TCTP, is an essential component of the tuberous sclerosis (see TSC1, 605284)-RHEB (601293) pathway. Reducing Drosophila Tctp levels reduced cell size, cell number, and organ size, which mimics Drosophila Rheb mutant phenotypes. Drosophila Tctp is genetically epistatic to Tsc1 and Rheb, but acts upstream of S6K (see 608938), a downstream target of Rheb. Drosophila Tctp directly associated with Rheb and displayed guanine nucleotide exchange activity with it in vivo and in vitro. Human TCTP showed similar biochemical properties compared to Drosophila Tctp and could rescue Drosophila Tctp mutant phenotypes, suggesting that the function of TCTP in the TSC pathway is evolutionarily conserved. Hsu et al. (2007) concluded that their studies identified TCTP as a direct regulator of RHEB.