Sequence 1213(HDV 1 , HDV1)
From Wikisequences
Sequence HDV_1 , HDV1 | |
---|---|
Target | TSG101 ( Homo sapiens ) |
Description | Tumor susceptibility gene 101
Ensembl: ENSG00000074319 UniGene: Hs.523512 EntrezGene: 7251 Ensembl Chr11: 18458438 - 18505065 Strand: -1 GO terms: 0001558 0003677 0003714 0005515 0005634 0005737 0006464 0006512 0007050 0008285 0015031 0016020 0019787 0030216 0045892 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GAAAGAAGTTAGAGGAACTTT / siRNA antisense (21b) AGTTCCTCTAACTTCTTTCTT |
Application | gene silencing |
Name | HDV_1 , HDV1 |
References
Susceptibility of human hepatitis delta virus RNAs to small interfering RNA action.Chang J, Taylor JM.J Virol. 2003 Sep;77(17) :9728-31.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478