Sequence 1214(Tsg101)
From Wikisequences
| Sequence Tsg101 | |
|---|---|
| Target | TSG101 ( Homo sapiens ) |
| Description | Tumor susceptibility gene 101
Ensembl: ENSG00000074319 UniGene: Hs.523512 EntrezGene: 7251 Ensembl Chr11: 18458438 - 18505065 Strand: -1 GO terms: 0001558 0003677 0003714 0005515 0005634 0005737 0006464 0006512 0007050 0008285 0015031 0016020 0019787 0030216 0045892 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CCTCCAGTCTTCTCTCGTCTT / siRNA antisense (21b) GACGAGAGAAGACTGGAGGTT |
| Application | gene silencing |
| Name | Tsg101 |
References
The role of LIP5 and CHMP5 in multivesicular body formation and HIV-1 budding in mammalian cells.Ward DM, Vaughn MB, Shiflett SL, White PL, Pollock AL, Hill J, Schnegelberger R, Sundquist WI, Kaplan J.J Biol Chem. 2005 Mar 18;280(11) :10548-55. Epub 2005 Jan 11.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
