Sequence 1217(SASi-652 , SASi652)
From Wikisequences
| Sequence SASi-652 , SASi652 | |
|---|---|
| Target | TSPAN31 ( Homo sapiens ) |
| Description | Tetraspanin 31
Ensembl: ENSG00000170745 UniGene: Hs.632708 EntrezGene: 6302 Ensembl Chr2: 17923426 - 17977705 Strand: 1 GO terms: 0005216 0005244 0005249 0005251 0005515 0005624 0006811 0006813 0008076 0015459 0016020 0030955 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GCATTCAGACGAAGCCCTGTT / siRNA antisense (21b) CAGGGCTTCGTCTGAATGCTT |
| Application | gene silencing |
| Name | SASi-652 , SASi652 |
References
Iterative microarray and RNA interference-based interrogation of the SRC-induced invasive phenotype.Irby RB, Malek RL, Bloom G, Tsai J, Letwin N, Frank BC, Verratti K, Yeatman TJ, Lee NH.Cancer Res. 2005 Mar 1;65(5) :1814-21.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
