Sequence 1221(ICBP90-2 , ICBP902)

Sequence ICBP90-2 , ICBP902
Target	UHRF1 ( Homo sapiens )
Description	Ubiquitin-like, containing PHD and RING finger domains, 1 Ensembl: ENSG00000034063 UniGene: Hs.108106 EntrezGene: 29128 Ensembl Chr19: 4860510 - 4913162 Strand: 1 GO terms: 0003700 0003702 0005515 0005634 0006281 0006350 0006357 0006464 0006512 0007049 0008270 0008283 0016874 0046872
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) TGAGTACGTCGATGCTCGGTT / siRNA antisense (21b) CCGAGCATCGACGTACTCATT
Application	gene silencing
Name	ICBP90-2 , ICBP902

References

Down-regulation of nuclear protein ICBP90 by p53/p21Cip1/WAF1-dependent DNA-damage checkpoint signals contributes to cell cycle arrest at G1/S transition.Arima Y, Hirota T, Bronner C, Mousli M, Fujiwara T, Niwa S, Ishikawa H, Saya H.Genes Cells. 2004 Feb;9(2) :131-42.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. UHRF1 binds to an inverted CCAAT box in the promoter of topoisomerase II-alpha (TOP2A; 126430). TOP2A introduces transient double-stranded breaks in DNA, which are required during the cell cycle for DNA replication, chromosome condensation, and segregation. UHRF1 is likely involved in TOPO2A expression (Hopfner et al., 2000). Gene Function. Hopfner et al. (2000) determined that ICBP90 bound the ICB2 of TOP2A in vivo and in vitro, and that expression of ICBP90 was concomitant with expression of TOP2A in human lung fibroblasts and several cell lines. Transfection of ICBP90 into COS-1 cells resulted in enhanced expression of both ICBP90 and TOP2A.

Bonapace et al. (2002) determined that mouse Np95 is an early target of the oncogenic DNA virus, adenovirus E1A, during induced proliferation. E1A induced Np95 expression in terminally differentiated mouse myotubes. The concomitant expression of Np95 and of cyclin E (123837)-Cdk2 (116953) was sufficient to induce S phase in these cells. In mouse fibroblasts, expression of Np95 was tightly regulated during the cell cycle, and its functional ablation abrogated DNA synthesis. Bonapace et al. (2002) concluded that Np95 is essential for S phase entry.

Unoki et al. (2004) demonstrated that ICBP90 bound to methylated CpG and to HDAC1 (601241) through its SET and RING finger-associated (SRA) domain. ICBP90 expression was increased by binding of E2F1 (189971) to its intron 1. Unoki et al. (2004) proposed that ICBP90 is involved in cell proliferation through methylation-mediated gene regulation.

Bostick et al. (2007) showed that the protein UHRF1, also known as NP95 in mouse and ICBP90 in human, is required for maintaining DNA methylation. UHRF1 colocalizes with the maintenance DNA methyltransferase protein DNMT1 (126375) throughout S phase. UHRF1 appears to tether DNMT1 to chromatin through its direct interaction with DNMT1. Furthermore, UHRF1 contains a methyl DNA binding domain, the SRA domain, that shows strong preferential binding to hemimethylated CG sites, the physiologic substrate for DNMT1. Bostick et al. (2007) concluded that UHRF1 may help recruit DNMT1 to hemimethylated DNA to facilitate faithful maintenance of DNA methylation.

Sharif et al. (2007) demonstrated that localization of mouse Np95 to replicating heterochromatin is dependent on the presence of hemimethylated DNA. Np95 forms complexes with Dnmt1 and mediates the loading of Dnmt1 to replicating heterochromatic regions. By using Np95-deficient embryonic stem cells and embryos, Sharif et al. (2007) showed that Np95 is essential in vivo to maintain global and local DNA methylation and to repress transcription of retrotransposons and imprinted genes. Sharif et al. (2007) concluded that the link between hemimethylated DNA, Np95, and Dnmt1 thus establishes key steps of the mechanism for epigenetic inheritance of DNA methylation. Animal Model.Muto et al. (2002) determined that inactivation of mouse Np95 was lethal to midgestation embryos. Using Np95 null embryonic stem cells, they found that lack of Np95 expression increased cell sensitivity to inhibition of DNA replication and to DNA damaging agents, including x-rays, ultraviolet light, and alkylation.