Sequence 1223(UPF1)

Sequence UPF1
Target	UPF1 ( Homo sapiens )
Description	UPF1 regulator of nonsense transcripts homolog ( yeast ) Ensembl: ENSG00000005007 UniGene: Hs.515266 EntrezGene: 5976 Ensembl Chr19: 18803744 - 18840038 Strand: 1 GO terms: 0000166 0000184 0000785 0003677 0003682 0003723 0004004 0004386 0005515 0005524 0005737 0006260 0006281 0006396 0006406 0006449 0007049 0008270 0016787 0017111 0046872
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) AAGATGCAGTTCCGCTCCATT / siRNA antisense (21b) TGGAGCGGAACTGCATCTTTT
Application	gene silencing
Name	UPF1

References

SMG7 acts as a molecular link between mRNA surveillance and mRNA decay.Unterholzner L, Izaurralde E.Mol Cell. 2004 Nov 19;16(4) :587-96.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. UPF1 is a helicase that shows RNA-dependent ATPase and 5-prime-to-3-prime RNA helicase activities. The ATPase activity of UPF1 is critical to the nonsense-mediated RNA decay (NMD) pathway, which targets mRNAs with premature termination codons for rapid degradation (summary by Franks et al., 2010). Gene Function. Perlick et al. (1996) found that expression of a chimeric protein containing the central region of human RENT1 flanked by the extreme N and C termini of yeast Upf1 complemented the Upf1-deficient growth phenotype in yeast. These data demonstrated that RENT1 is a mammalian ortholog of Upf1. Sun et al. (1998) provided evidence for a factor that functions to eliminate the production of nonsense-containing RNAs in mammalian cells. They identified the factor, variously referred to as RENT1 and HUPF1, by isolating cDNA for a human homolog of S. cerevisiae Upf1p, which is a group I RNA helicase that functions in the nonsense-mediated decay of mRNA in yeast. Using monkey COS cells and human HeLa cells, Sun et al. (1998) demonstrated that expression of human Upf1 protein harboring an arginine-to-cysteine mutation at residue 844 within the RNA helicase domain acts in a dominant-negative fashion to abrogate the decay of nonsense-containing mRNA that takes place in association with nuclei or in the cytoplasm. These findings provided evidence that nonsense-mediated mRNA decay is related mechanistically in yeast and in mammalian cells, regardless of the cellular site of decay.

Mendell et al. (2002) assessed the role of factors essential for NMD in nonsense-mediated altered splicing (NAS) with the use of RNA interference in mammalian cells. Inhibition of RENT1 expression abrogated both NMD and NAS of nonsense T-cell receptor beta (TCRB; see 186930) transcripts. In contrast, inhibition of RENT2 (UPF2; 605529) expression did not disrupt NAS despite achieving comparable stabilization of nonsense transcripts. Mendell et al. (2002) also demonstrated that NAS and NMD are genetically separable functions of RENT1. Mendell et al. (2002) demonstrated that RENT1 enters the nucleus, where it may directly influence early events in mRNA biogenesis. Mendell et al. (2002) concluded that their results provide compelling evidence that NAS relies on a component of the nonsense surveillance machinery but is not an indirect consequence of NMD.

Using immunoprecipitation and immunodepletion experiments, Ohnishi et al. (2003) showed that SMG5 (610962) and SMG7 (610964) associated with a hyperphosphorylated form of UPF1, and that SMG5 was involved in UPF1 dephosphorylation by the protein phosphatase-2A (PP2A; see 176915) complex. SMG5 mutants that interfered with UPF1 dephosphorylation also inhibited nonsense-mediated mRNA decay in a dominant-negative manner.

Amrani et al. (2004) used a primer extension inhibition (toeprinting) assay to delineate ribosome positioning and found that premature translation termination in yeast extracts is indeed aberrant. Ribosomes encountering premature UAA or UGA codons in the Can1 mRNA failed to release and, instead, migrated to upstream AUGs. This anomaly depended upon prior nonsense codon recognition and was eliminated in extracts derived from cells lacking the principal NMD factor Upf1p, or by flanking the nonsense codon with a normal 3-prime untranslated region (UTR). Tethered poly(A)-binding protein (Pab1p), used as a mimic of a normal 3-prime UTR, recruited the termination factor Sup35p (eRF3) and stabilized nonsense-containing mRNAs. Amrani et al. (2004) concluded that efficient termination and mRNA stability are dependent on a properly configured 3-prime UTR. Animal Model.Medghalchi et al. (2001) explored the consequences of loss of NMD function in vertebrates through targeted disruption of the Rent1 gene, which encodes a mammalian ortholog of Upf1p, in murine embryonic stem cells. Mice heterozygous for the targeted allele showed no apparent phenotypic abnormalities but homozygosity was never observed, demonstrating that Rent1 is essential for embryonic viability. Homozygous targeted embryos showed complete loss of NMD and were viable in the preimplantation period, but resorbed shortly after implantation. Furthermore, Rent1 -/- blastocysts isolated at 3.5 days postcoitum underwent apoptosis in culture following a brief phase of cellular expansion. The authors hypothesized that NMD is essential for mammalian cellular viability and supports a critical role for the pathway in the regulated expression of selected physiologic transcripts.