Sequence 1229(M VEGF)
Sequence M VEGF | |
---|---|
Target | Vegfa ( Mus musculus ) |
Description | Vascular endothelial growth factor A
Ensembl: ENSMUSG00000023951 UniGene: Mm.282184 EntrezGene: 22339 Ensembl Chr17: 46153942 - 46168699 Strand: -1 GO terms: 0000074 0001541 0001569 0001666 0001938 0001974 0002053 0005604 0005615 0005737 0006916 0007275 0007399 0007498 0008083 0008201 0008283 0009967 0016020 0016477 0030324 0030855 0042088 |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (21b) CATCTTCAAGCCGTCCTGTGT / Reverse PCR primer (21b) CTCCAGGGCTTCATCGTTACA |
Application | gene expression |
Name | M VEGF |
References
Molecular biomarkers of vascular dysfunction in obstructive sleep apnea.Kaczmarek E, Bakker JP, Clarke DN, Csizmadia E, Kocher O, Veves A, Tecilazich F, O'Donnell CP, Ferran C, Malhotra A.PLoS One. 2013 Jul 29;8(7) :e70559. doi: 10.1371/journal.pone.0070559. Print 2013.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478