Sequence 1239(LZR-8 , LZR8)
From Wikisequences
Sequence LZR-8 , LZR8 | |
---|---|
Target | vp3 ( HRV-16 ) |
Description | |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGACTGCAAACACTACCTTTT / siRNA antisense (21b) AAGGTAGTGTTTGCAGTCCTT |
Application | gene silencing |
Name | LZR-8 , LZR8 |
References
Small interfering RNA molecules as potential anti-human rhinovirus agents: in vitro potency, specificity, and mechanism.Phipps KM, Martinez A, Lu J, Heinz BA, Zhao G.Antiviral Res. 2004 Jan;61(1) :49-55.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478