Sequence 1246(siWAVE3-a , siWAVE3a)

Sequence siWAVE3-a , siWAVE3a
Target	WASF3 ( Homo sapiens )
Description	WAS protein family, member 3 Ensembl: ENSG00000118515
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) TAGTACTCTTGCCGCTATCTT / siRNA antisense (21b) GATAGCGGCAAGAGTACTATT
Application	gene silencing
Name	siWAVE3-a , siWAVE3a

References

WAVE3 promotes cell motility and invasion through the regulation of MMP-1, MMP-3, and MMP-9 expression.Sossey-Alaoui K, Ranalli TA, Li X, Bakin AV, Cowell JK.Exp Cell Res. 2005 Aug 1;308(1) :135-45. Exp Cell Res. 2013 Mar 10;319(5) :775. Exp Cell Res. 2010 Oct 15;316(17) :3006.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. By Northern blot analysis, Waldegger et al. (1997) characterized the levels of a 2.6-kb SGK transcript in HepG2 cells in response to osmotic changes. Transcription levels were rapidly raised with exposure to hypertonicity and decreased with hypotonicity. The transcriptional control mechanism was very sensitive to extracellular molarity, and the induction of SGK RNA was independent of de novo protein synthesis. The SGK mRNA had a short half-life. The authors also determined that it was cell volume rather than osmolarity that modified transcriptional regulation of SGK in HepG2 cells, and showed that comparable changes in transcript levels occurred in MDCK (Madin-Darby-Canine kidney) cells. However, unlike previous observations in rat mammary tumor cells, they did not detect changes in SGK transcript levels after treatment of HepG2 cells with glucocorticoids or fetal calf serum.

Transforming growth factor-beta (TGFB1; 190180) participates in the pathophysiology of diabetic complications. TGF-beta stimulates the expression of SGK. Lang et al. (2000) demonstrated markedly enhanced transcription of SGK in diabetic nephropathy (see 603933), with particularly high expression in mesangial cells, interstitial cells, and cells in the thick ascending limbs of the loop of Henle and distal tubules. The enhanced SGK transcription, which results from excessive extracellular glucose concentrations, stimulates renal tubular Na(+) transport. These observations disclosed an additional element in the pathophysiology of diabetic nephropathy.

Kobayashi et al. (1999) reported that PKD1 (601313) activated SGK1 by phosphorylation of thr256. When expressed in human embryonic kidney cells, IGF1 (147440) and peroxide significantly activated SGK1, and activation could be abolished by preincubation with inhibitors of PI3 kinase (see 171833).

Using several breast cancer cell lines, Mikosz et al. (2001) determined that the antiapoptotic effect of glucocorticoid receptor (GCCR; 138040) activation involved SGK1. SGK1 expression was rapidly induced after GCCR activation by serum withdrawal, and ectopic expression of SGK1 inhibited apoptosis in the absence of all growth factors. Expression of a kinase-dead SGK1 mutant (lys127 to met) did not inhibit apoptosis. Mikosz et al. (2001) concluded that SGK1 is a downstream target of GCCR-mediated cell survival and that it is primarily regulated at the level of transcription.

Gamper et al. (2002) found that expression of SGK1, SGK2 (607589), and SGK3 (SGKL; 607591) in human embryonic kidney cells and Xenopus oocytes significantly stimulated voltage-gated K(+) channels. K(+) currents were fully blocked by tetraethylammonium chloride and partially inhibited by a Kv1 (see 176260) channel blocker.Animal Model.Using differential display PCR, Tsai et al. (2002) identified 98 cDNA fragments from the rat dorsal hippocampus that were expressed differentially between the fast learners and slow learners in the water maze learning task. One of these cDNA fragments came from the Sgk gene. Northern blot analysis showed that Sgk mRNA levels were approximately 4-fold higher in the hippocampus of fast learners than slow learners. In situ hybridization results indicated that Sgk mRNA levels were increased markedly in the CA1, CA3, and dentate gyrus of the hippocampus of fast learners. Transient transfection of Sgk mutant DNA to the CA1 area of the hippocampus impaired water maze performance in rats, whereas transfection of Sgk wildtype DNA facilitated it.

Salker et al. (2011) expressed a constitutively active SGK1 mutant in the luminal epithelium of the mouse uterus, which prevented expression of certain endometrial receptivity genes, perturbed uterine fluid handling, and abolished embryo implantation. In contrast, implantation was unhindered in Sgk1 -/- mice, but pregnancy was often complicated by bleeding at the decidual-placental interface, with fetal growth retardation and subsequent demise. Compared to wildtype mice, Sgk1-deficient mice also had gross impairment of pregnancy-dependent induction of genes involved in oxidative stress defenses.