Sequence 1249(XIAP)

Sequence XIAP
Target	XIAP ( Homo sapiens )
Description	X-linked inhibitor of apoptosis protein Ensembl: ENSG00000101966 UniGene: Hs.356076 , Hs.560150 , Hs.598042 , Hs.626277 EntrezGene: 331 Ensembl ChrX: 122821729 - 122875503 Strand: 1 GO terms: 0004869 0005515 0005622 0005737 0005829 0006915 0006916 0008270 0043027 0043154 0046872
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GTGGTAGTCCTGTTTCAGCTT / siRNA antisense (21b) GCTGAAACAGGACTACCACTT
Application	gene silencing
Name	XIAP

References

A novel role for XIAP in copper homeostasis through regulation of MURR1.Burstein E, Ganesh L, Dick RD, van De Sluis B, Wilkinson JC, Klomp LW, Wijmenga C, Brewer GJ, Nabel GJ, Duckett CS.EMBO J. 2004 Jan 14;23(1) :244-54. Epub 2003 Dec 18.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. XIAP, HIAP1 (601721), and HIAP2 (601712) belong to a human multigene family whose members show extensive homology to baculovirus IAPs (inhibitor of apoptosis proteins) and encode proteins that demonstrate significant inhibition of apoptosis.Gene Function. Deveraux et al. (1997) showed that human X-linked IAP directly inhibits at least 2 members of the caspase family of cell-death proteases, caspase-3 (CASP3; 600636) and caspase-7 (CASP7; 601761). As the caspases are highly conserved throughout the animal kingdom and are the principal effectors of apoptosis, these findings suggested how IAPs might inhibit cell death, providing evidence for a mechanism of action for these mammalian cell-death suppressors.

To determine why proteasome inhibitors prevent thymocyte death, Yang et al. (2000) examined whether proteasomes degrade antiapoptotic molecules in cells induced to undergo apoptosis. The HIAP2 and XIAP inhibitors of apoptosis were selectively lost in glucocorticoid- or etoposide-treated thymocytes in a proteasome-dependent manner before death. IAPs catalyzed their own ubiquitination in vitro, an activity requiring the RING domain. Overexpressed wildtype HIAP2, but not a RING domain mutant, was spontaneously ubiquitinated and degraded, and stably expressed XIAP lacking the RING domain was relatively resistant to apoptosis-induced degradation and, correspondingly, more effective at preventing apoptosis than wildtype XIAP. Yang et al. (2000) concluded that autoubiquitination and degradation of IAPs may be a key event in the apoptotic program.

XIAP interacts with caspase-9 (CASP9; 602234) and inhibits its activity, whereas SMAC (605219) relieves this inhibition through interaction with XIAP. Srinivasula et al. (2001) demonstrated that XIAP associates with the active caspase-9-APAF1 (602233) holoenzyme complex through binding to the amino terminus of the linker peptide on the small subunit of caspase-9, which becomes exposed after proteolytic processing of procaspase-9 at asp315. Supporting this observation, point mutations that abrogate the proteolytic processing but not the catalytic activity of caspase-9, or deletion of the linker peptide, prevented caspase-9 association with XIAP and its concomitant inhibition. Srinivasula et al. (2001) noted that the N-terminal 4 residues of caspase-9 linker peptide share significant homology with the N-terminal tetrapeptide in mature SMAC and in the Drosophila proteins Hid/Grim/Reaper, defining a conserved class of IAP-binding motifs. Consistent with this finding, binding of the caspase-9 linker peptide and SMAC to the BIR3 domain of XIAP is mutually exclusive, suggesting that SMAC potentiates caspase-9 activity by disrupting the interaction of the linker peptide of caspase-9 with BIR3. Srinivasula et al. (2001) concluded that their studies reveal a mechanism in which binding to the BIR3 domain of XIAP by 2 conserved peptides, one from SMAC and the other from caspase-9, has opposing effects on caspase activity and apoptosis.

IKKB (603258) is required for NFKB (see 164011) activation by TNFA (191160), whereas IKKA (600664) is dispensable. Using immune complex kinase assays to measure the effect of TNFA on the activities of IKK and JNK (e.g., 602897) in wildtype or RelA (164014)-, IKKA-, or IKKB-deficient mouse embryonic fibroblasts, Tang et al. (2001) found that JNK activation is transient in wildtype and Ikka -/- fibroblasts but sustained in RelA -/- and Ikkb -/- cells. In contrast, IKK activation was also transient but robust in Ikka -/- and wildtype fibroblasts but severely impaired in Ikkb -/- cells. Immunoblot analysis showed that Tnfa induced expression of XIAP in wildtype but not RelA -/- cells, indicating that XIAP is targeted by NFKB. Transient expression of XIAP in HeLa cells inhibited JNK activation by TNFA without affecting JNK expression levels. Expression of a dominant-negative JNKK2 (603014) mutant (K149M) or a constitutively active JNKK2-JNK1 (601158) fusion protein attenuated or enhanced, respectively, JNK activation and, in RelA -/- fibroblasts, cell death. Tang et al. (2001) concluded that IKK negatively modulates JNK activity, most likely through the induction of NFKB target genes encoding proteins such as XIAP, which interfere with TNFA-mediated, but not IL1 (147760)-mediated, JNK activation and apoptosis.

Sanna et al. (2002) determined that ILPIP (ALS2CR2; 607333) potentiates the antiapoptotic activity of XIAP by enhancing XIAP-mediated activation of JNK1 and other JNK family members, but not by modulating XIAP-mediated caspase inhibition. They also found that expression of a catalytically inactive TAK1 (MAP3K7; 602614) mutant blocked the XIAP/ILPIP activation of JNK1. In vivo coprecipitation experiments showed that both ILPIP and XIAP interact with TAK1 and TRAF6 (602355). Sanna et al. (2002) concluded that XIAP-mediated protection from apoptosis utilizes both a JNK1 activation pathway that involves ILPIP and a caspase inhibition pathway that is independent of ILPIP. Animal Model.Harlin et al. (2001) generated mice deficient in Xiap through homologous gene targeting. The Xiap -/- mice were viable, histopathologically normal, and lacked defects in caspase-dependent or -independent apoptosis. However, the levels of Ciap1 and Ciap2 were increased, suggesting the existence of a compensatory mechanism in the absence of XIAP expression that may be provided by these molecules.