Sequence 1250(XLOC 000170 , XLOC000170)

Sequence XLOC_000170 , XLOC000170
Target	XLOC_000170 ( Nicotiana benthamiana )
Description
Design	primer set
Chemistry	DNA
Sequence	Forward PCR primer (21b) AACGCAATCGAGGATAAACTG / Reverse PCR primer (19b) CATTTGCTGCTGGACCTTC
Application	gene expression
Name	XLOC_000170 , XLOC000170

References

Deep sequencing-based transcriptome profiling reveals comprehensive insights into the responses of Nicotiana benthamiana to beet necrotic yellow vein virus infections containing or lacking RNA4.Fan H, Sun H, Wang Y, Zhang Y, Wang X, Li D, Yu J, Han C.PLoS One. 2014 Jan 9;9(1) :e85284. doi: 10.1371/journal.pone.0085284. eCollection 2014.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background