Sequence 1257(XLOC 006860 , XLOC006860)
From Wikisequences
| Sequence XLOC_006860 , XLOC006860 | |
|---|---|
| Target | XLOC_006860 ( Nicotiana benthamiana ) |
| Description | |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (20b) CCCGTGACAGAGTTAGCTAC / Reverse PCR primer (22b) ACCAATCAACCATCTGACGGTA |
| Application | gene expression |
| Name | XLOC_006860 , XLOC006860 |
References
Deep sequencing-based transcriptome profiling reveals comprehensive insights into the responses of Nicotiana benthamiana to beet necrotic yellow vein virus infections containing or lacking RNA4.Fan H, Sun H, Wang Y, Zhang Y, Wang X, Li D, Yu J, Han C.PLoS One. 2014 Jan 9;9(1) :e85284. doi: 10.1371/journal.pone.0085284. eCollection 2014.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
