Sequence 1259(XLOC 008050 , XLOC008050)

Sequence XLOC_008050 , XLOC008050
Target	XLOC_008050 ( Nicotiana benthamiana )
Description
Design	primer set
Chemistry	DNA
Sequence	Forward PCR primer (20b) TCAATTGAACCACGTGCACC / Reverse PCR primer (21b) ATTGCTCTTCGCTCCTTGACA
Application	gene expression
Name	XLOC_008050 , XLOC008050

References

Deep sequencing-based transcriptome profiling reveals comprehensive insights into the responses of Nicotiana benthamiana to beet necrotic yellow vein virus infections containing or lacking RNA4.Fan H, Sun H, Wang Y, Zhang Y, Wang X, Li D, Yu J, Han C.PLoS One. 2014 Jan 9;9(1) :e85284. doi: 10.1371/journal.pone.0085284. eCollection 2014.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background